Tel:400 179 0116,17521589219

Cell, culture reagent, life science research overall service provider!

Current position:Home > Products > Cell Lines & Customized Cells > MicroRNA Agomir/Antagomir > Animal MicroRNAs (hsa-miR-)  > MIRacle™ mmu-miR-3072-5p miRNA Agomir/Antagomir

Products Resources产品中心

CONTACT US

Current position:Home > Products > Cell Lines & Customized Cells > MicroRNA Agomir/Antagomir > Animal MicroRNAs (hsa-miR-)  > MIRacle™ mmu-miR-3072-5p miRNA Agomir/Antagomir
  • MIRacle™ mmu-miR-3072-5p miRNA Agomir/Antagomir

MIRacle™ mmu-miR-3072-5p miRNA Agomir/Antagomir

No.:AM4354

Price: ¥8820 ¥12240 ¥71640

specification:
2OD
amount: - +
  • MIRacle™ mmu-miR-3072-5p miRNA Agomir/Antagomir
Products Description
Accession Number: MIMAT0014852 Mature Sequence: AGGGACCCCGAGGGAGGGCAGG mmu-miR-3072-5p are small non-coding RNAs of 2022 nucleotides, typically excised from 60110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. AcceGen has extended experience in agomir/antagomir synthesis services that cover all human, mouse and rat miRNAs in the current miRbase. Compared to standard miRNA mimics and inhibitors, agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies. Deliverables: Agomir and/or antagomir, DEPC H2O. 1 OD corresponds to 33 ug.
download
Related products
×